UNIVERSIDADE ESTADUAL PAULISTA
“JÚLIO DE MESQUITA FILHO”
Instituto de Ciência e Tecnologia
Campus de São José dos Campos
ORIGINAL ARTICLE DOI: https://doi.org/10.4322/bds.2023.e3660
1
Braz Dent Sci 2023 Jan/Mar;26 (1): e3660
Effect of radiotherapy on the differentiation and osteogenic
activity of mesenchymal stem cells on dental implants
Efeito da radioterapia na diferenciação e atividade osteogênica de células-tronco mesenquimais em implantes dentários
Fernanda Herrera da COSTA
1
, Mateus José DUTRA
1
, Luana Marotta Reis de VASCONCELLOS
1
,
Mariana Raquel da Cruz VEGIAN
1
, Camila Duarte da SILVA
1
, Hanna Flávia Santana dos SANTOS
1
,
Claudio Antonio FEDERICO
2
, Renata Falchete do PRADO
3
, Rubens Nisie TANGO
3
, Estela KAMINAGAKURA
1
1 - Universidade Estadual Paulista, Instituto de Ciência e Tecnologia, Departamento de Biociências e Diagnóstico Bucal, São José dos
Campos, São Paulo, Brazil.
2 - Instituto de Estudos Avançados, Departamento de Ciência e Tecnologia Aeroespacial, São José dos Campos, São Paulo, Brazil.
3 - Universidade Estadual Paulista, Instituto de Ciência e Tecnologia, Departamento de Materiais Dentários e Prótese Dentária, São José
dos Campos, São Paulo, Brazil.
How to cite: Costa FH, Dutra MJ, Vasconcellos LMR, Vegian MRC, Silva CD, Santos HFS, et al. Effect of radiotherapy on the
differentiation and osteogenic activity of mesenchymal stem cells on dental implants. Braz. Dent. Sci. 2023;26(1):e3660. https://doi.
org/10.4322/bds.2023.e3660
ABSTRACT
Objective: to evaluate the differentiation and gene expression of transcripts related to osteogenesis in a primary
culture of Mesenchymal Stem Cells (MSCs) derived from rat femurs submitted to radiotherapy and the installation
of pure titanium implants. Material and Methods: fty-four rats received titanium implants in both femurs and
were divided into three groups: Control: implant surgery (C); Implant + immediate irradiation (IrI), and Implant
+ late irradiation (IrL). Euthanasia occurred 3, 14, and 49 days after surgery. The bone marrow MSCs from the
femurs were isolated and cultivated. The cell viability, total protein content, alkaline phosphatase (ALP) activity,
and the formation of mineralization nodules and cellular genotoxicity were analyzed. The gene expression of
Alkaline Phosphatase (phoA), Collagen 1 (COL1), Runt-related transcription factor 2 (RUNX2), Osterix (OSX),
Osteopontin (OPN), Integrin β
1
(ITGB
1
), Bone Sialoprotein (BSP), Osteonectin (SPARC), Osteocalcin (Bglap),
Transforming Growth Factor β-type (TGF-β), Granulocyte-Macrophage Colony Stimulating Factor (GM-CSF),
Interleukin-6 (IL-6), Apolipoprotein E (APOE)
and
Prostaglandin E
2
synthase (PGE
2
)
were evaluated by qRT-
PCR. Results: ionizing radiation suppresses the gene expression of essential transcripts for bone regeneration,
as well as cellular viability, as observed in the IrI and IrL groups. Conclusion: although this can lead to the loss
of osseointegration and failure of the implant, the MSCs showed more activity at 49 days than at 3 and 14 days.
KEYWORDS
Cancer treatment protocol; Osseointegration; Osteogenesis; Bone regeneration; Dental implants.
RESUMO
Objetivo: avaliar a diferenciação e expressão gênica de transcritos relacionados à osteogênese em cultura primária
de MSCs derivadas de fêmures de ratos submetidos à radioterapia e instalação de implantes de titânio puro.
Material e Métodos: cinquenta e quatro ratos receberam implantes de titânio em ambos os fêmures e foram
divididos em três grupos: Controle: cirurgia de implante (C); Implante + irradiação imediata (IrI) e Implante
+ irradiação tardia (IrL). A eutanásia ocorreu 3, 14 e 49 dias após a cirurgia. As MSCs de medula óssea dos
fêmures foram isoladas e cultivadas. Foram analisadas a viabilidade celular, teor de proteína total, atividade da
fosfatase alcalina (ALP), formação de nódulos de mineralização e genotoxicidade celular. A expressão gênica de
Fosfatase Alcalina (phoA), Colágeno 1 (COL1), fator de transcrição relacionado a Runt 2 (RUNX2), Osterix (OSX),
2
Braz Dent Sci 2023 Jan/Mar;26 (1): e3660
Costa FH et al.
Effect of radiotherapy on the differentiation and osteogenic activity of mesenchymal stem cells on dental implants
Costa FH et al.
Effect of radiotherapy on the differentiation and osteogenic
activity of mesenchymal stem cells on dental implants
INTRODUCTION
Ionizing radiation is commonly used in the
treatment of head and neck cancer. However,
bone regeneration becomes compromised
after irradiation because of the reduction of
cellular activity, vascular supply, and local
oxygenation [1]. The main alterations after
radiation occur in osteoblasts, resulting in the
alteration of bone matrix formation capacity [1].
Mesenchymal stem cells (MSCs) are
fundamental in bone regeneration after
irradiation [2]. They exhibit a high proliferative
rate and high differentiation potential; however,
the irradiation can alter the differentiation of
osteoblasts [3]. This potential of MSCs to repair
the damage resulting from ionizing radiation and
to repopulate the medullary compartment is one
of the signs in irradiated patients for verifying
their tolerance to radiotherapy [3,4]. The number
of osteoblasts decreases, and consequently
collagen production and the porosity of the
cortical bone increases [5].
Although radiation decreases the vitality of
tissues, oral implants have been used for patient
rehabilitation [6] to reestablish mastication and
to provide xation for maxillo-facial prostheses,
with improvements in phonetics, esthetics, patient
comfort, and quality of life [7]. In addition,
the presence of implants can change the local
radiation doses and distribution [6,8] and can
alter the therapeutic scheme.
The aim of this study was to evaluate
the effects of radiotherapy on the viability,
genotoxicity, differentiation, and gene expression
prole of related transcripts to early and late
osteogenesis in the primary culture of MSCs
from rat femurs submitted to the installation of
titanium implants before radiotherapy.
MATERIAL AND METHODS
Animals
Fifty-four male Wistar rats (
Rattus norvegicus
albinus) weighing about 300 g were maintained in
cages (n = 6) and given water and feed
ad libitum
.
This experiment was approved by the Research
Ethics Committee of Unesp No. 003/2016 and
followed all the recommendations of the Animal
Research: Reporting In Vivo Experiments
(ARRIVE) guidelines for the execution and
submission of studies on animals [9].
The 54 rats were subdivided into 3 groups
(n = 18): Group Control (C); Implant Group IrI:
Implant + immediate irradiation after 24 hours;
and Group IrL: Implant + late irradiation after
4 weeks. They were each submitted to the
installation of pure titanium implants, (5 mm in
length and 3.5 mm in diameter) in both femurs
and were subsequently euthanized. In groups C
and IrI, euthanasia was performed 3, 14, and
49 days after implant surgery. In group IrL,
euthanasia was performed 3, 14 and 49 days
after radiotherapy.
Ionizing irradiation procedure
The delivered radiation doses were traceable
to the national metrological standard by means
of a farmer-type ionization chamber and
electrometer, and a batch of dosimeter, TLD-
800 (lithium borate manganese Li2B4O7: Mn),
was used (Thermo Scientic Inc.) to continuously
monitoring the radiation incidence during each
procedure according to thermoluminescent
dosimetry methodology. The parameters for
obtaining the pre-established luminescence
curve, as used by the IEAv Aerospace Dosimetry
Laboratory (LDA) for irradiations performed
in the
60
Co gamma beam, were produced by
Osteopontina (OPN), Integrina β1 (ITGB1), Sialoproteína Óssea (BSP), Osteonectina (SPARC), Osteocalcina
(Bglap), Fator de Crescimento Transformador tipo β (TGF-β), Fator Estimulante de Colônia de Granulócitos-
Macrófagos (GM-CSF), Interleucina-6 (IL-6), Apolipoproteína E (APOE) e Prostaglandina E2 sintase (PGE2)
foram
avaliados por qRT-PCR. Resultados: a radiação ionizante suprime a expressão gênica de transcritos essenciais
para a regeneração óssea, bem como a viabilidade celular, como observado nos grupos IrI e IrL. Conclusão:
embora isso possa levar à perda da osseointegração e falha do implante, as MSCs apresentaram maior atividade
aos 49 dias do que aos 3 e 14 dias.
PALAVRAS-CHAVE
Protocolo de tratamento do câncer; Osseointegração; Osteogênese; Regeneração óssea; Implantes dentários.
3
Braz Dent Sci 2023 Jan/Mar;26 (1): e3660
Costa FH et al.
Effect of radiotherapy on the differentiation and osteogenic activity of mesenchymal stem cells on dental implants
Costa FH et al.
Effect of radiotherapy on the differentiation and osteogenic
activity of mesenchymal stem cells on dental implants
Eldorado 78 irradiator teletherapy from Atomic
Energy of Canadian Limited, located in the IEAv
Ionizing Radiation Laboratory (LRI). The animals
were anesthetized and positioned in immobilizers
previously developed to reproduce the irradiation
site [10]. The femurs were irradiated in two
steps within 24 hours, at a mean source-object
distance of 48 cm from the rats, with dose rates of
17.6 Gy/h in the tissue (femur) and over an area
of 2 cm, according to Cunha et al. (2007) [11].
Analysis of changes in animals
The animals were monitored for clinical
changes such as eating habits, hair loss, surgical
wound infection, and weight loss. At the
beginning of the experiment and immediately
prior to euthanasia, all animals were weighed
on a semi-analytical scale. The weight changes
were recorded as a percentage, and a weight loss
of less than 20% of body weight was considered
acceptable [12].
Primary osteoblast culture
The femur was used in the primary cultures
of osteoblasts, which were isolated from cells by
washing the bone marrow with osteogenic culture
medium according to Rosa et al. (2008) [13].
Subsequently, these cells were distributed in
culture asks of 75 cm
2
(Nunc, Denmark) and
incubated at 37 ºC with 5% CO
2
(Ultrasafe
HF 212 UV Incubator). The culture medium
was replaced every three days, and the culture
progression evaluated by inverted-phase
microscopy (Carl Zeiss Microscope - Axiovert
40C, Germany). Two flasks were grown per
group and period, and, after conuency, each
one was plated with a total of 2×10
4
viable cells
in each well of a 24-well plate (Nunc, Denmark)
to evaluate cell viability, alkaline phosphatase
activity, the formation of mineralization nodules,
and cellular genotoxicity.
In another flask, after confluence, the
culture medium was removed, and 3 mL of Trizol
Reagent (Ambion, Life Technologies Corporation,
Van Allen Way, Carlsbad, California, USA) was
added. The cells were lysed, and their contents
were collected and stored in a freezer at -80 °C
according to the manufacturer’s guidelines.
MTT assay
To evaluate cell viability, the cells were
cultured in the wells and evaluated after 48 hours
and 7 days. The cells were incubated for 4 hours
with MTT dye (3-4,5-dimethylthiabromide),
(Sigma Aldrich Inc, Darmstadt, Germany) in
the proportion of 10 μL of 5 mg/mL of MTT
dissolved in PBS for each well, followed by
spectrophotometric analysis of the incorporated
dye using colorimetric measurement on a
microplate reader at a wavelength of 570 nm
(Biotek EL808IU).
Alkaline phosphatase (ALP) activity
To evaluate ALP activity, the cells were
cultured in the wells and evaluated after 48 hour
and 7 days. ALP activity was determined by the
release of thymolphthalein by hydrolysis of the
thymolphthalein monophosphate substrate using
a commercial kit according to the manufacturer’s
instructions (Labtest Diagnostica). The absorbance
was measured with a spectrophotometer (Micronal
AJX 1900) using a wavelength of 590 nm, and
ALP activity was calculated from the standard
curve using thymolphthalein on a scale of 0.012 to
0.4 μmol of thymolphthalein/hour/μg protein.
The level of ALP was normalized against the
total protein concentration. The total protein was
estimated from each individual sample [14].
Mineralization assay
The cells were incubated at 37 °C/5%CO
2
for
14 days after which the formation of mineralization
nodules was quantied using Alizarin S 2% red
staining (Sigma Aldrich Inc, Darmstadt, Germany),
which consists of xing the cell culture using 4%
paraformaldehyde, exposure to alizarin S red dye
for 30 min at room temperature, and washing
with phosphate-buffered saline. The extraction
of the nodules by acetic acid was measured in the
spectrophotometer at 405 nm [15].
Genotoxicity test
Cells were fixed in 4% formaldehyde on
the seventh day after plating, and uoroshield
4- 6-diamidine-2-phenylindole solution (DAPI;
Sigma-Aldrich) was added to each well. The cells
were photographed using a digital camera (Sony
F828 digital, Cyber-Shot, 8.0 megapixels; Sony
Corporation, Tokyo, Japan) in an inverted light
microscope. At least 10 images per well were
obtained, and the genotoxicity analysis was
performed from a total of 20,000 cells using
Image J software (National Institutes of Health,
Bethesda, MD).
4
Braz Dent Sci 2023 Jan/Mar;26 (1): e3660
Costa FH et al.
Effect of radiotherapy on the differentiation and osteogenic activity of mesenchymal stem cells on dental implants
Costa FH et al.
Effect of radiotherapy on the differentiation and osteogenic
activity of mesenchymal stem cells on dental implants
Evaluation of gene expression by qRT-PCR
cDNA synthesis was performed by reverse
transcription reactions according to the instructions
from SuperScript III First-Strand Synthesis
Supermix Kit, (Invitrogen Life Technologies
Corporation-Van Allen Way, Carlsbad, California,
USA). cDNA specimens were stored at -20 ºC.
The cDNA was then used for RT-PCR with the
Step One Plus Time PCR System (Thermosher
Scientfic Inc Waltham, Massachusetts, USA)
using the SYBR Green Platinum System qPCR
SuperMix-UDG (Invitrogen Life Technologies
Corporation-Van Allen Way, Carlsbad, California,
USA). Specic primers and 2 μL of cDNA were
used in each reaction. The primers are listed in
Table I. The specimens were submitted to real-time
polymerase chain reaction (50 °C for 2 minutes
followed by initial denaturation at 95 °C for
2 minutes and a further 40 cycles alternating 95 °C
for 15 seconds and 60 °C for 40 seconds).
Table I - Descriptions of forward and reverse sequences, fragment length (pair of bases), and NCBI of genes related to early and late phase
of osteogenesis and osteoclastogenesis
Gene
Sequence
Fragment
length (pb)
NCBI
Forwad (F)/ Reverse (R)
Genes related to early osteogenesis
Alkaline phosphatase (phoA)
F TATGTCTGGAACCGCACTGAAC
192 XM_006239136.3
R CACTAGCAAGAAGAAGCCTTTGGG
Collagen-1 (COL1)
F CCAACGAGATCGAGCTCAGG
101 NM_053304.1
R GACTGTCTTGCCCCAAGTTCC
Runt-related transcription factor 2
(RUNX2)
F GCCGGAATGATGAGAACTA
200 NM_001278483.1
R GGACCGTCCACTGTCACTTT
Osterix (OSX)
F CAAGAGTCGGATTCTAGGATTGGAT
208 NM_001037632.1
R CAAACTTGCTGCAGGCTGCT
Osteopontin (OPN)
F ATCTGATGAGTCCTTCACTG
151 NM_012881.2
R GGGATACTGTTCATCAGAAA
Integrin β1 (ITGB1)
F GGAGAAAACTGTGATGCCATACAT
85 NM_017022.2
R TGGGCTGGTACAGTTTTGTTCA
Genes related to late osteogenesis
Bone Sialoprotein (BSP)
F CTACTTTTATCCTCCTCTGAAACGGTT
202 NM_012587.2
R GCTAGCGGTTACCCCTGAGA
Osteonectin (SPARC)
F CTCCCATTGGCGAGTTTG
129 NM_012656.1
R TGTAGTCCAGGTGGAGCTTGTG
Osteocalcin (Bglap)
F GAGGGCAGTAAGGTGGTGAA
154 NM_013414.1
R CGTCCTGGAAGCCAATGTG
Transforming Growth Factor β-type
(TGF-β)
F GGACTCTCCACCTGCAAGAC
R CTCTGCAGGCGCAGCTCTG
63 NM_021578.2
Genes related to Osteoclastogenesis
Granulocyte Macrophage Colony
Stimulating Factor (GM-CSF)
F CCGACACAGGCTCTTCTATTCAG
84 XM_008761428.2
R CAGCCAGCAAGACTAGGATGA
Interleukin-6 (IL-6)
F TCCTACCCCAACTTCCAATGCTC
79 NM_012589.2
R TTGGATGGTCTTGGTCCTTAGCC
Apolipoprotein E (APOE)
F TGTTGGTCCCATTGCTGACAGGAT
382 NM_001270681.1
R TGGTGTTTACCTCGTTGCGGTACT
Protaglandin E2 synthase (PGE2)
F CATGATCTACCCTCCCCACG
67 NM_017232.3
R CAGACCAAAGACTTCCTGCCC
Reference gene
β-actin
F GCAGGAGTACGATGAGTCCG
74 NM_031144.3
R ACGCAGCTCAGTAACAGTCC
NCBI: Reference Sequence National Center for Biotechnology Information.
5
Braz Dent Sci 2023 Jan/Mar;26 (1): e3660
Costa FH et al.
Effect of radiotherapy on the differentiation and osteogenic activity of mesenchymal stem cells on dental implants
Costa FH et al.
Effect of radiotherapy on the differentiation and osteogenic
activity of mesenchymal stem cells on dental implants
The Ct (Threshold Cycle) values of the specimens
were used in the following calculations [16].
The mean of the biological triplicates of each gene
was calculated for all specimens, and the Ct of the
constituent gene was subtracted: ΔCt = Ct (gene)
-Ct (constitutive). The ΔCt was subtracted from
the calibrator specimen, resulting in ΔΔCt: ΔΔCt =
ΔCt-ΔCt (calibrator). Relative Quantication (RQ)
was then calculated for each gene in each specimen
according to the equation:
2
Ct
RQ
− ∆∆
=
(1)
Statistical analysis
Data from the MTT assay, alkaline phosphatase
activity and mineralization nodules formation
were submitted to ANOVA, and the Tukey tests
for comparison among the groups. The Spearman
correlation test was used to evaluate the gene
expression. All tests were performed using GraphPad
Prism 7.03 software (GraphPad Software INC, La
Jolla, CA, USA). The level of signicance was 5%.
RESULTS
Fifty-four animals were operated on, of which
6 were lost (11.1%); 2 died in the postoperative
period of implant installation, and 4 others from
the effects of irradiation. However, other alterations
were observed in some animals, especially in the
groups that remained for longer periods between
irradiation and euthanasia, such as the animals in
the 49-day groups that experienced hair loss, skin
wounds, surgical site infections, and tissue necrosis.
MTT assay
Concentration absorbance values were
signicant in all groups (p <0.005). Absorbance
values were lower than 50% in the IrI and IrL
groups (p = 0.012 and p = 0.027, respectively).
Alkaline phosphatase (ALP) activity
In the IrI and IrL groups, the ALP activity was
detected at day 3, 14 and at day 49, the higher rate
was observed, reaching up to 58% (p <0.005).
Mineralization formation
Nodular structure was observed in all groups
as shown in Figure 1A-1C. In the IrI group, the
coloration of mineralized nodules in all periods
of time decreased compared with the control
group. However, at 49 days, the mineralization
nodule formations in the IrI and IrL groups
increased, with a statistically signicant difference
(p = 0.017 and p < 0.005, respectively). In the
IrL group, the increase reached 63.9%, with a
signicant difference in all periods of time.
Genotoxicity (micronuclei formation)
In group C, the nuclei were similar to normal.
In the 3-day test, a total of 475 cells was counted
and, over time, that number declined, whereas at
14 days the mean number of cells was 271 and at
49 days 211. Despite the decline in the number of
cells, no atypia or presence of micronuclei were
observed in any of the specimens.
In the IrL group, at 3 days, a reduced number
of stained nuclei was observed, and all presented
an aberrant appearance. At 14 and 49 days, the
cells were apparently recovering and multiplying
but still with aberrant DNA. In the IrI group, they
proliferated, however, aberrant DNA was present
at 3 days to 49 days.
Effect of radiotherapy on mesenchymal cell’s
gene expression
Early phase of osteogenesis
In the present animal study, the mesenchymal
cells presented similar behavior after implant
Figure 1 - Photomicrographs of mineralization nodule at 21 days. (A) Control group showing a large number of cells around the osteo-like
nodules; (B) IrI group has an intermediate number of cells but fewer mineralization nodules; (C) IrL group has a smaller number of cells but
shows a mineralization nodule. Alizarin S 2% red stain. 40× magnification.
6
Braz Dent Sci 2023 Jan/Mar;26 (1): e3660
Costa FH et al.
Effect of radiotherapy on the differentiation and osteogenic activity of mesenchymal stem cells on dental implants
Costa FH et al.
Effect of radiotherapy on the differentiation and osteogenic
activity of mesenchymal stem cells on dental implants
installation and at different irradiation intervals.
The genes
OSX, phoA,
and
COL1
related to the
initial osteogenesis phase were downregulated
in the 3 periods evaluated. However, at
49 days, more
phoA
RNAm transcripts were
observed in the IrI group compared with 3 and
14 days (p < 0.05 and p = 0.001, respectively).
In the IrL group,
phoA
RNAm transcripts were
downregulated in all periods.
The
RUNX2
gene expression was irregular in
all irradiated groups at 3 and 14 days, in the IrL
group, at 3 days it was hyperregulated (p < 0.0001),
and its expression was reduced at 14 to 49 days
(p = 0.0001 and p = 0.001 respectively).
ITGB1
was downregulated in the 2 groups
irradiated at 3 days (p = 0.023 and p = 0.013),
but its transcripts were found at the subsequent
periods in the IrI (p = 0.103 and p = 0.045)
and IrL (p = 0.045 and p = 0.114) groups.
OPN
was hyperexpressed in the IrI group at 3 and
14 days (p = 0.043, p = 0.141) but, at 49 days,
it was downregulated (p = 0.042). In the IrL, its
expression was similar to that of the control group
at 3 days (p = 0.124), but, at 14 days (p = 0.042),
it was hyperregulated until 49 days (p = 0.043).
In the IrI group, the
phoA
expression was
directly correlated to
RUNX2
(p = 0.016) and
OSX (
p = 0.033
)
expression, with a signicant
difference. The
RUNX2
and
OSX
transcripts
tended to correlate to
ITGB1 and OPN
, but these
differences were not statistically signicant. In the
IrL group, no signicant correlation was found
among different gene expressions.
Late phase of osteogenesis
The genes
Bglap, SPARC,
and
TGF-β
e
BSP
are expressed in the late phase of osteogenesis.
The
Bglap, SPARC
, and
BSP
transcripts were
downregulated in the IrI and IrL groups in all
periods analyzed.
The
TGF-β
genes were hyperregulated in
the irradiated group. MSCs from the IrI group,
hyperexpressed this gene at 3 and 49 days
(p = 0.013, p = 0.0004, respectively) compared
with the control. Similar results were found
in IrL group, these transcripts were higher at
3 (p = 0.042), 14 (p = 0.012), and at 49 days
(p < 0.0001). There was correlation between
BSP
and
OSX
expression (p = 0.2); however, there
was not signicance in the IrI group.
The genes
APOE, PGE2, IL-6
e
GM-CSF
were evaluated as well. At day 3, 14 and 49, its
APOE
expression in the IrI group was similar to
that in the control group (p = 0.053, p = 0.107,
p = 0.0727, respectively). In the IrL group,
RNAm transcripts were similar to those in the
control group at day 3 (p = 0.063), but at 14 and
49 days, it was hyperregulated (p = 0.0001 and
p = 0.0002, respectively).
The
PGE2
RNAm was overexpressed in
the IrI group at 3 and 49 days (p = 0.023 and
p = 0.019, respectively). In the IrL group, the
expression was similar to that in the control group
at 3 and 49 days (p = 0.140 and p = 0.129,
respectively).
The
IL-6
was hyperregulated in the IrI
group at 3 days (p = 0.029), but subexpressed at
14 (p = 0.0007) and 49 days (p = 0.019). In the
IrL group, it was hyperexpressed at 3 (p = 0.042)
until 14 (p = 0.016) days when it started to
decline until 49 days (p = 0.0192). No difference
was found between
GM-CSF
expression at 3 and
14 days (p = 0.840 and p = 0.157, respectively)
in the IrI group, being overexpressed at 49 days
in the IrI and IrL groups (p = 0.0015 and
p = 0.0057, respectively). A correlation was
found between
GM-CSF
and
PGE2
expression (p
= 0.174) and
GM-CSF
between
Il-6
(p = 0.23)
but, there was no significant difference from
the IrI group. Figure 2 summarizes these gene
expressions.
DISCUSSION
Ionization irradiation causes local infection,
suture dehiscence, and mucositis [12,17,18].
In the present study, alopecia, ulceration and
radiodermatitis were observed. We investigated
two different periods of implant installation
prior to the radiotherapy: IrI that mimicked
oral cavity management for preradiotherapy
treatment, the advantages of which include early
oral rehabilitation that improves oral function
such as speech and swallowing [6,19]; and
IrL that evaluated the effects of radiotherapy
on previously osseointegrated dental implants.
The radiation dose at the bone implant interface
is increased from scattering by the dental
implants when they are installed in the radiation
eld and can alter both soft and hard tissues [20].
In both situations, the dose inuences osseous
tissue integrity and can lead to an imbalance in
osteoblast and osteoclast activity. The increase
7
Braz Dent Sci 2023 Jan/Mar;26 (1): e3660
Costa FH et al.
Effect of radiotherapy on the differentiation and osteogenic activity of mesenchymal stem cells on dental implants
Costa FH et al.
Effect of radiotherapy on the differentiation and osteogenic
activity of mesenchymal stem cells on dental implants
in the concentration of osteoclasts and the
decrease in the osteocytes and osteoblasts after
irradiation [21], favors osteonecrosis and impairs
the osseointegration process.
A cell viability test by MTT assay
demonstrated that γ-ray exposure signicantly
reduced cell population in the IrI and IrL groups.
In our study, the number of viable cells in the IrI
group in the 48-hour period was similar to that
of the control group, but, at 7 days, a signicant
decrease was found in the number of cells, and
the DNA of these cells was aberrant. At 49 days,
the cells were larger in number compared with at
3 and 7 days, and the DNA was again aberrant.
The irradiated groups presented irregular ALP
activity when compared with the control group;
however, in all groups, mineralization nodules
were observed. The number of mineralization
nodules were inversely proportional to the dose
received [22]. As MSC can resist radiation as a
response to stress [3,4,23], these cells, when
submitted to ionizing radiation, exhibit a higher
antioxidant capacity in order to eliminate reactive
oxygen species [23]. In our study, despite the
presence of total protein, alkaline activity, and
mineralization nodules in the irradiated groups
at the different periods, the quantity and quality
of the bone were low around the implants in an
in vivo
model (unpublished data).
Upon radiation, the
RUNX2
gene expression
was affected in all groups at 3 and 14 days, and
its expression started reducing at 14 to 49 days.
RUNX2 plays an essential role in differentiating
pluripotential cells into preosteoblasts. In the
next phase, preosteoblasts differentiate into
mature osteoblasts, a process in which OSX plays
a critical role [24]. RUNX2 is downregulated by
OSX [21]. The latter is required for osteoblast
differentiation and bone formation.
OSX
knock-
out mice lacked bone completely [24]. Inhibition
of osteoblast differentiation and the high number
of immature osteoblasts in adult mice Osx
ox/–
;Col1a1-Cre resulted in delayed trabecular bone
and osteopenic cortical bone formation [21].
Figure 2 - Expression of transcripts essential for differentiation into osteoblast-like cells at 3, 14, and 49 days. Significant difference *p ≤ 0.05;
**p≤ 0.005; ***p ≤ 0.0005.
8
Braz Dent Sci 2023 Jan/Mar;26 (1): e3660
Costa FH et al.
Effect of radiotherapy on the differentiation and osteogenic activity of mesenchymal stem cells on dental implants
Costa FH et al.
Effect of radiotherapy on the differentiation and osteogenic
activity of mesenchymal stem cells on dental implants
The
OSX
gene inactivation decreased
Bglap
expression and the accumulation of
OPN
-positive
cells [21], similar to our results. In addition,
the
OPN
regulation depends on mechanisms
involving the intersection of three pathways,
RUNX2, Vitamin D receptor, and Notch signaling,
in osteoblastic cells [25].
OSX is required for the expression of the
osteoblast’s markers such as
COL1, Bglap,
BSP, SPARC,
and
OPN
[24]. In our study, the
genes
OSX, phoA,
and
COL1,
related to the
initial osteogenesis phase, were downregulated.
The irradiation decreases collagen production,
increases the number of empty lacunae in the
cortical bone [5], and leads to less hydroxyapatite
deposition [26].
ITGB1
was downregulated in the IrI and IrL
groups irradiated at 3 days, but their transcripts
were found to be similar to those of the control
group at the subsequent periods. Integrins have
an essential role in cell–cell and cell–extracellular
matrix adhesion, in osteoblast function and survival
and, in osteoclast activity. The ablation of integrin
regulator integrin β1-binding protein 1 (ICAP1)
in osteoblasts results in defective osteoblast
proliferation, differentiation and function,
decreased bronectin and
COL1
deposition, and
delayed bone formation in mice [27,28].
All genes normally expressed in the late
phase of the osteogenesis evaluated in the present
study were downregulated, except for
TGF-β
,
which was hyperregulated in the irradiated group
in almost all periods. This result was comparable
with 2-week
in vivo
results that reported that
the early irradiated group exhibited higher
TGF-β protein values than the control group,
probably stimulated by the surgical procedures
and irradiation trauma [10].
The genes
PGE2, GM-CSF
, and
IL-6
were
upregulated in our study. The
IL-6
transcripts
were upregulated at 3 up to 14 days in the IrI and
IrL groups. IL-6 was secreted by hMSCs at day
1 after irradiation and started declining at day
7 until day 21, regardless of the dose and implant
surface [29]. The release of IL-6 and GM-CSF
contributes to pathological bone resorption by
stimulating the differentiation of mononuclear
phagocyte osteoclast precursors into mature
bone-resorbing cells [10,30]. PGE2 signaling
can protect cells from apoptosis and initiate
stem cell self-renewal, and it is possible that
up-regulation of PGE2 synthesis is an endogenous
mechanism for radioprotection. In bone marrow,
PGE2 production has been reported not to reach a
maximum until several days after irradiation [31]
as we demonstrated. A viable stem cell will
naturally produce high levels of immune-response
factors after any trauma or external inuence,
such as irradiation [29].
Interestingly, the
APOE
in the IrL group, at
14 and 49 days, was hyperregulated, suggesting
that cells in this group could be quiescent [32,33].
In contrast, the APOE deletion in mouse models
improves bone fracture healing by increasing
bone formation and matrix mineralization [33].
Limitations of the current study include its
in vitro
design with a lack of microenvironment
interaction. The bone vasculature can be damaged
by direct radiation action [6] or indirectly by free
radical production that deteriorates bone marrow
blood vessels [26]. The MSCs can partially
recover their activity in rats after 49 days of
radiotherapy in contrast with the findings of
Cao et al. (2011) [26]. In the preclinical model,
irradiation is related to the bone marrow MSCs
dysfunction that impairs bone formation and
increases osteoclast activity, contributing to a rapid
collapse of bone quantity and quality [34,35].
CONCLUSION
Based on our results, the majority transcripts
of genes in the early and late phase of osteogenesis
were downregulated. The radiation led to an
osteogenesis and osteoclastogenesis imbalance;
however, MSCs activity is partially recovered in
rats after approximately 49 days.
Acknowledgements
This study was supported by a grant
from the Fundação de Amparo à Pesquisa do
Estado de São Paulo/FAPESP. Research Grant
(15/24986-8), undergraduate Fellowship to
Silva, CD (16/25246-0) and Master`s Fellowship
to Costa, FH (16/20103-7). We thank to Odair
Gonçalez and the technical team of the Institute
of Advanced Studies, São Jose dos Campos/SP/
Brazil for assistance during irradiation of the
rats. We are grateful to Emls Comércio Produtos
Odontológicos® for donating the implants.
Author’s Contributions
FHC, LMRV, MRCV, CDS, RFP, RNT, EK:
Experimental Design. FHC, LMRV, MRCV, CDS,
9
Braz Dent Sci 2023 Jan/Mar;26 (1): e3660
Costa FH et al.
Effect of radiotherapy on the differentiation and osteogenic activity of mesenchymal stem cells on dental implants
Costa FH et al.
Effect of radiotherapy on the differentiation and osteogenic
activity of mesenchymal stem cells on dental implants
RFP, RNT, EK: Laboratory Processes. FHC, LMRV,
MRCV, CDS, RFP, RNT, EK: Sample Collection.
FHC, LMRV, MRCV, CDS, RFP, RNT, EK, MJD,
HFSS, CF: Formal Analysis. FHC, LMRV, MRCV,
CDS, RFP, RNT, EK, MJD, HFSS, CAF: Writing –
Review & Editing.
Conict of Interest
No conicts of interest declared concerning
the publication of this article.
Funding
We thank São Paulo Research Foundation –
FAPESP, for nancing and granting a scholarship
to FHC, process nº 16/20103-7.
Regulatory Statement
This study was conducted in accordance with
all the provisions of the guidelines and policies
of the Brazilian National Animal Care Ethical
Council (CONCEA), and the animal experimental
protocol was approved by the Animal Ethics
Committee (CEUA 003/2016) of the Institute of
Science and Technology at São José dos Campos/
UNESP.
REFERENCES
1. Williams HJ, Davies AM. The effect of X-rays on bone: a pictorial
review. Eur Radiol. 2006;16(3):619-33. http://dx.doi.org/10.1007/
s00330-005-0010-7. PMid:16237551.
2. Kandy A, Fareed N, Basavarajappa MK, Battur H, Praveena
J. Dental stem cells in intraoral regenerative therapy: a
systematic review. Braz Dent Sci. 2022;25(2): e2771. https://
doi.org/10.4322/bds.2022.e2771.
3. Singh S, Kloss FR, Brunauer R, Schimke M, Jamnig A,
Greiderer-Kleinlercher B,etal. Mesenchymal stem cells show
radioresistance in vivo. J Cell Mol Med. 2012;16(4):877-87. http://
dx.doi.org/10.1111/j.1582-4934.2011.01383.x. PMid:21762375.
4. Nicolay NH, Perez RL, Debus J, Huber PE. Mesenchymal stem
cells – a new hope for radiotherapy-induced tissue damage?
Cancer Lett. 2015;366(2):133-40. http://dx.doi.org/10.1016/j.
canlet.2015.06.012. PMid:26166559.
5. Aitasalo K. Bone tissue response to irradiation and treatment
model of mandibular irradiation injury. An experimental
and clinical study. Acta Otolaryngol Suppl. 1986;428:1-54.
PMid:3090854.
6. Doh RM, Kim S, Keum KC, Kim JW, Shim JS, Jung HS, etal.
Postoperative irradiation after implant placement: a pilot study
for prosthetic reconstruction. J Adv Prosthodont. 2016;8(5):363-
71. http://dx.doi.org/10.4047/jap.2016.8.5.363. PMid:27826386.
7. Kobayashi Y, Sumida T, Ishikawa A, Mori Y. The contribution
of dental implants to functional artificial restoration after
treatment of oral cancer. Anticancer Res. 2016;36(6):3053-6.
PMid:27272826.
8. Ozen J, Dirican B, Oysul K, Beyzadeoglu M, Ucok O, Beydemir B.
Dosimetric evaluation of the effect of dental implants in head
and neck radiotherapy. Oral Surg Oral Med Oral Pathol Oral
Radiol Endod. 2005;99(6):743-7. http://dx.doi.org/10.1016/j.
tripleo.2004.11.048. PMid:15897862.
9. Kilkenny C, Browne WJ, Cuthill IC, Emerson M, Altman DG.
Improving bioscience research reporting: the ARRIVE guidelines
for reporting animal research. PLoS Biol. 2010;8(6):e1000412.
http://dx.doi.org/10.1371/journal.pbio.1000412. PMid:20613859.
10. Vegian MRC, Costa BCA, Santana-Melo GF, Godoi FHC,
Kaminagakura E, Tango RN, etal. Systemic and local effects
of radiotherapy: an experimental study on implants placed
in rats. Clin Oral Investig. 2020;24(2):785-97. http://dx.doi.
org/10.1007/s00784-019-02946-5. PMid:31154539.
11. Cunha SS, Sarmento V, Ramalho LM, Almeida D, Veeck EB, Costa
NP,etal. Effect of laser therapy on bone tissue submitted to
radiotherapy: experimental study in rats. Photomed Laser Surg.
2007;25(3):197-204. http://dx.doi.org/10.1089/pho.2007.2002.
PMid:17603861.
12. Sønstevold T, Johannessen AC, Stuhr L. A rat model of radiation
injury in the mandibular area. Radiat Oncol. 2015;10(1):129.
http://dx.doi.org/10.1186/s13014-015-0432-6. PMid:26050968.
13. Rosa ML, Beloti MM, Prando N, Queiroz RH, Oliveira PT, Rosa
AL. Chronic ethanol intake inhibits in vitro osteogenesis
induced by osteoblasts differentiated from stem cells. J Appl
Toxicol. 2008;28(2):205-11. http://dx.doi.org/10.1002/jat.1271.
PMid:17582586.
14. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein
measurement with the Folin phenol reagent. J Biol Chem.
1951;193(1):265-75. http://dx.doi.org/10.1016/S0021-
9258(19)52451-6. PMid:14907713.
15. Vasconcellos LM, Barbara MA, Deco CP, Junqueira JC, Prado
RF, Anbinder AL, et al. Healing of normal and osteopenic
bone with titanium implant and low-level laser therapy
(GaAlAs): a histomorphometric study in rats. Lasers Med Sci.
2014;29(2):575-80. http://dx.doi.org/10.1007/s10103-013-1326-
1. PMid:23624654.
16. Livak KJ, Schmittgen TD. Analysis of relative gene expression
data using real-time quantitative PCR and the 2(-Delta Delta
C(T)) method. Methods. 2001;25(4):402-8. http://dx.doi.
org/10.1006/meth.2001.1262. PMid:11846609.
17. Bonan PR, Kaminagakura E, Pires FR, Vargas PA, Almeida OP.
Cytokeratin expression in initial oral mucositis of head and
neck irradiated patients. Oral Surg Oral Med Oral Pathol Oral
Radiol Endod. 2006;101(2):205-11. http://dx.doi.org/10.1016/j.
tripleo.2005.03.033. PMid:16448923.
18. Mohamed NH, Kamel AM, Edress MF, Mahmoud ASS, Gaafar
AIAE. Low level laser therapy versus benzydamin in prevention
and treatment of oral mucositis induced by anticancer
treatments (clinical and biochemical study). Braz Dent Sci.
2022;25(4):e3406. https://doi.org/10.4322/bds.2022.e3406
19. Brasseur M, Brogniez V, Grégoire V, Reychler H, Lengelé B,
D’Hoore W, et al. Effects of irradiation on bone remodelling
around mandibular implants: an experimental study in dogs.
Int J Oral Maxillofac Surg. 2006;35(9):850-5. http://dx.doi.
org/10.1016/j.ijom.2006.03.016. PMid:16697145.
20. Teramoto Y, Kurita H, Kamata T, Aizawa H, Yoshimura N, Nishimaki
H,etal. A case of peri-implantitis and osteoradionecrosis arising
around dental implants placed before radiation therapy. Int J
Implant Dent. 2016;2(1):11. http://dx.doi.org/10.1186/s40729-
016-0039-1. PMid:27747703.
21. Baek WY, Lee MA, Jung JW, Kim SY, Akiyama H, Crombrugghe
B,etal. Positive regulation of adult bone formation by
osteoblast-specific transcription factor osterix. J Bone Miner Res.
2009;24(6):1055-65. http://dx.doi.org/10.1359/jbmr.081248.
PMid:19113927.
10
Braz Dent Sci 2023 Jan/Mar;26 (1): e3660
Effect of radiotherapy on the differentiation and osteogenic
activity of mesenchymal stem cells on dental implants
Costa FH et al.
Effect of radiotherapy on the differentiation and osteogenic activity of mesenchymal stem cells on dental implants
Costa FH et al.
Effect of radiotherapy on the differentiation and osteogenic
activity of mesenchymal stem cells on dental implants
Date submitted: 2022 Oct 14
Accept submission: 2022 Dec 01
Estela Kaminagakura
(Corresponding address)
Universidade Estadual Paulista, Instituto de Ciência e Tecnologia, Departamento de
Biociências e Diagnóstico Bucal, Av. Eng. Francisco José Longo, 777, Jd. São Dimas,
São José dos Campos, São Paulo, Brazil.
Email: estela.tango@unesp.br
22. Dare A, Hachisu R, Yamaguchi A, Yokose S, Yoshiki S, Okano T.
Effects of ionizing radiation on proliferation and differentiation
of osteoblast-like cells. J Dent Res. 1997;76(2):658-64. http://
dx.doi.org/10.1177/00220345970760020601. PMid:9062559.
23. Chen MF, Lin CT, Chen WC, Yang CT, Chen CC, Liao SK,etal.
The sensitivity of human mesenchymal stem cells to ionizing
radiation. Int J Radiat Oncol Biol Phys. 2006;66(1):244-53. http://
dx.doi.org/10.1016/j.ijrobp.2006.03.062. PMid:16839703.
24. Tang W, Li Y, Osimiri L, Zhang C. Osteoblast-specific transcription
factor Osterix (Osx) is an upstream regulator of Satb2 during
bone formation. J Biol Chem. 2011;286(38):32995-3002. http://
dx.doi.org/10.1074/jbc.M111.244236. PMid:21828043.
25. Shen Q, Christakos S. The vitamin D receptor, Runx2, and the
Notch signaling pathway cooperate in the transcriptional
regulation of osteopontin. J Biol Chem. 2005;280(49):40589-98.
http://dx.doi.org/10.1074/jbc.M504166200. PMid:16195230.
26. Cao X, Wu X, Frassica D, Yu B, Pang L, Xian L,etal. Irradiation
induces bone injury by damaging bone marrow microenvironment
for stem cells. Proc Natl Acad Sci USA. 2011;108(4):1609-14.
http://dx.doi.org/10.1073/pnas.1015350108. PMid:21220327.
27. Brunner M, Millon-Frémillon A, Chevalier G, Nakchbandi IA,
Mosher D, Block MR,etal. Osteoblast mineralization requires
beta1 integrin/ICAP-1-dependent fibronectin deposition.
J Cell Biol. 2011;194(2):307-22. http://dx.doi.org/10.1083/
jcb.201007108. PMid:21768292.
28. Marie PJ. Targeting integrins to promote bone formation and
repair. Nat Rev Endocrinol. 2013;9(5):288-95. http://dx.doi.
org/10.1038/nrendo.2013.4. PMid:23358353.
29. Printzell L, Reseland JE, Edin NFJ, Ellingsen JE. Effects of
ionizing irradiation and interface backscatter on human
mesenchymal stem cells cultured on titanium surfaces. Eur J
Oral Sci. 2019;127(6):500-7. http://dx.doi.org/10.1111/eos.12654.
PMid:31322296.
30. Neale SD, Sabokbar A, Howie DW, Murray DW, Athanasou NA.
Macrophage colony-stimulating factor and interleukin-6 release
by periprosthetic cells stimulates osteoclast formation and
bone resorption. J Orthop Res. 1999;17(5):686-94. http://dx.doi.
org/10.1002/jor.1100170510. PMid:10569477.
31. Hoggatt J, Singh P, Stilger KN, Plett PA, Sampson CH, Chua
HL,et al. Recovery from hematopoietic injury by modulating
prostaglandin E(2) signaling post-irradiation. Blood Cells
Mol Dis. 2013;50(3):147-53. http://dx.doi.org/10.1016/j.
bcmd.2012.11.006. PMid:23206586.
32. Fukada S, Uezumi A, Ikemoto M, Masuda S, Segawa M, Tanimura
N,etal. Molecular signature of quiescent satellite cells in adult
skeletal muscle. Stem Cells. 2007;25(10):2448-59. http://dx.doi.
org/10.1634/stemcells.2007-0019. PMid:17600112.
33. Huang R, Zong X, Nadesan P, Huebner JL, Kraus VB, White
JP,etal. Lowering circulating apolipoprotein E levels improves
aged bone fracture healing. JCI Insight. 2019;4(18):e129144.
http://dx.doi.org/10.1172/jci.insight.129144. PMid:31534056.
34. Kondo H, Searby ND, Mojarrab R, Phillips J, Alwood J, Yumoto
K,etal. Total-body irradiation of postpubertal mice with (137)
Cs acutely compromises the microarchitecture of cancellous
bone and increases osteoclasts. Radiat Res. 2009;171(3):283-9.
http://dx.doi.org/10.1667/RR1463.1. PMid:19267555.
35. Sun R, Zhu G, Wang J, Tong L, Zhai J. Indirect effects of
X-irradiation on proliferation and osteogenic potential of bone
marrow mesenchymal stem cells in a local irradiated rat model.
Mol Med Rep. 2017;15(6):3706-14. http://dx.doi.org/10.3892/
mmr.2017.6464. PMid:28440500.
